Journal of Postgraduate Medicine
 Open access journal indexed with Index Medicus & ISI's SCI  
Users online: 1302  
Home | Subscribe | Feedback | Login 
About Latest Articles Back-Issues Articlesmenu-bullet Search Instructions Online Submission Subscribe Etcetera Contact
 :: Next article
 :: Previous article 
 :: Table of Contents
 ::  Similar in PUBMED
 ::  Search Pubmed for
 ::  Search in Google Scholar for
 ::Related articles
 ::  Article in PDF (569 KB)
 ::  Citation Manager
 ::  Access Statistics
 ::  Reader Comments
 ::  Email Alert *
 ::  Add to My List *
* Registration required (free) 

  IN THIS Article
 ::  Abstract
 ::  Materials and Me...
 ::  Results
 ::  Discussion
 ::  Materials and Me...
 ::  Results
 ::  Discussion
 ::  References

 Article Access Statistics
    PDF Downloaded353    
    Comments [Add]    
    Cited by others 5    

Recommend this journal


Year : 2006  |  Volume : 52  |  Issue : 3  |  Page : 179-182

Development and application of multiplex polymerase chain reaction for the etiological diagnosis of infectious endophthalmitis

Larsen & Toubro Microbiology Research Centre, Vision Research Foundation, No.18, College Road, Sankara Nethralaya, Chennai - 600 006, Tamil Nadu, India

Correspondence Address:
H N Madhavan
Larsen & Toubro Microbiology Research Centre, Vision Research Foundation, No.18, College Road, Sankara Nethralaya, Chennai - 600 006, Tamil Nadu
Login to access the Email id

Source of Support: None, Conflict of Interest: None

PMID: 16855317

Rights and PermissionsRights and Permissions

 :: Abstract 

Background: Uniplex polymerase chain reaction (PCR) for detection of bacterial and panfungal genome has been applied onto a large number of intraocular fluids facilitating management of infective endophthalmitis. Aim: To develop and apply a novel, rapid multiplex polymerase chain reaction (mPCR) to detect the presence of eubacterial, Propionibacterium acnes and panfungal genomes in intraocular fluids from patients clinically diagnosed to have infective endophthalmitis. Settings and Design: Prospective study . Materials and Methods: Conventional methods of direct microscopy by KOH/calcofluor mount, Gram's staining and culture were done on 30 (19 Aqueous humor-AH and 11 Vitreous fluid-VF) intraocular specimens and mPCR done for simultaneous detection of eubacterial, P. acnes and panfungal genomes. Results: mPCR detected an infectious etiology in 18 (60%) of 30 intraocular specimens. Eubacterial genome was detected in 12 (40%) specimens, P. acnes genome in 4 (13.3%) specimens and panfungal genome in 2 (6.6%) specimens. mPCR results correlated with those of uniplex PCR. mPCR results were available within 5-6 hours after receipt of specimen, as against 8 hours required for each uniplex PCR with three separate thermalcyclers for their completion. Consumption of Taq polymerase was reduced considerably for mPCR. Conclusion: mPCR is a cost effective, single tube method for the simultaneous detection of eubacterial, P. acnes and panfungal genomes in intraocular specimens from patients with infective endophthalmitis. It is a more rapid procedure than uniplex PCRs and requires only a single thermalcycler.

Keywords: Multiplex PCR, polymerase chain reaction, aqueous humor, vitreous fluid, infectious endophthalmitis

How to cite this article:
Bagyalakshmi R, Madhavan H N, Therese K L. Development and application of multiplex polymerase chain reaction for the etiological diagnosis of infectious endophthalmitis. J Postgrad Med 2006;52:179-82

How to cite this URL:
Bagyalakshmi R, Madhavan H N, Therese K L. Development and application of multiplex polymerase chain reaction for the etiological diagnosis of infectious endophthalmitis. J Postgrad Med [serial online] 2006 [cited 2021 Feb 25];52:179-82. Available from:

Infective endophthalmitis is a serious ocular infection that can result in blindness. Approximately 70% of cases occur as a direct complication of intraocular surgery.[1],[2] The diagnosis of infective endophthalmitis is on clinical grounds; but negative cultures are frequently encountered, (21-63%)[3] resulting in a dilemma. The results of conventional methods of direct smear are available within half an hour and, culture results are available at 48 hours (for bacteria) and at 10 days (for fungus and anaerobic bacteria). In contrast, polymerase chain reaction (PCR) results are available within 8 hours and hence PCR had proved to be a rapid, reliable and sensitive tool in diagnosis of infective endophthalmitis. multiplex polymerase chain reaction (mPCR) has been widely used for detection and characterization of genes of bacteria[4],[5],[6] and viral retinitis.[7] It is important to have a rapid and sensitive test that would help resolve the dilemma by detecting the genomes of common infectious agents simultaneously.

 :: Materials and Methods Top

Thirty intraocular specimens (19 AH and 11 VF), collected from 25 patients referred to an ophthalmic hospital, during June-August 2004 with clinical diagnosis of infective endophthalmitis, after cataract or lens surgeries were investigated for detection of the causative infectious agent.

Conventional microbiological investigations

Both AH and VF were processed for KOH /calcofluor and Gram staining techniques and for culture of bacteria and fungi by standard microbiological methods.[8],[9],[10] In brief, the intraocular specimens were inoculated onto blood agar (incubated aerobically at 37ºC), chocolate agar (incubated in 10% CO 2 at 37ºC),  Brucella More Details blood agar (incubated anaerobically in Don Whitley Compact anaerobic work station, Thane, India), brain heart infusion broth and thioglycollate broth. Sabouraud's dextrose agar was used for isolation of fungus, and other aerobic media with no growth at the end of 48 hours were incubated for a period of 10 days to isolate fungus. The isolated microorganisms were identified by standard protocols. The smears made from AH and VF using the cytospin (Cytospin 2, Shandon, USA) were stained by Gram staining and KOH /calcofluor preparations for the detection of bacteria and fungus respectively.

PCR assay conditions for detection of eubacterial, P. acnes and panfungal genomes

DNA was extracted from the intraocular specimens of AH and VF by Qiagen kit (Qiagen, Germany, catalogue 51304) method according to the manufacturer's instructions. nPCR was carried out using eubacterial primers targeting for 16SrRNA[2] and panfungal genome targeting 28SrRNA[11] as described previously.

Assay conditions for mPCR

For a 50 μl reaction, 8 μl of 200 μm dNTPs, 5 μl of 10 x PCR buffer (5 mM MgCl 2 , 500 mM KCl, 100 mM Tris Cl, (0.01% gelatin), 0.36 micromole of primers for eubacterial genome: U 1 5' TTGGAGAGTTTGATCCTGGCTC 3', rU 4 5' GGACTACCAGGGTATCTAA 3' (first round) U 2 5' GGCGTGCTTA ACACATGCAAGTCG 3', U 3 5' GCG GCTGGCACGTAGTTAG 3' (second round), 1 micromole of P. acnes primers Pa 1 : 5' AAGGCCCTGCTTTTGTGG 3' rPa 3 5' ACTCACGCTTCGTCACAG 3' (first round) and Pa 1 and rPa 2 5' TCCATCCGCAACCGCCGAA 3' for the second round were used. For panfungal genome detection, 10 picomoles of forward primer FU 1 5' TGAAATTGTTGAAAGGGAA 3' and reverse primer FU 2 - 5' GACTCCTTGGTCCGTGTT 3' were used. The primers and PCR reagents were obtained from Bangalore Genei, India Amplification of the three genomes was carried out in a single tube using 10 μl of template DNA in Perkin Elmer thermalcycler (Model 2700) with the same thermal profile of Therese et al[2] for 25 cycles. Nested amplification for detection of eubacterial and P. acnes genomes was carried out with the same thermal profile for 10 cycles.

Sensitivity and specificity

Sensitivity of mPCR was determined using serial ten-fold dilutions of DNA of Staphylococcus aureus (ATCC 12228), of a laboratory isolate of P. acnes and of C. albicans (ATCC 24433); specificity of mPCR assay was determined using standard ATCC strains of  Escherichia More Details coli (ATCC 25922) , Pseudomonas aeruginosa, (ATCC 7853), Staphylococcus aureus Scientific Name Search  (ATCC 12228) , Mycobacterium tuberculosis H37Rv, HSV 1 ATCC 733 VR and human leukocyte DNA.

 :: Results Top

Sensitivity and specificity of mPCR

The specificity and sensitivity of both the nPCR tests for detection of eubacterial and P. acnes genome were 40 fg and 50 fg as published previously. The sensitivity of multiplex PCR for detection of eubacterial genome and P. acnes genome was 100 fg and for panfungal genome was 0.4 pg. The primers were specific when amplified by multiplex reaction amplifying the respective targets. The results of sensitivity of mPCR after first round of amplification are shown in [Figure 1]A and after second round of amplification are shown in [Figure 1]B.

The results of mPCR for detection of eubacterial, P. acnes and panfungal genomes are given in [Table 1]. The results of individual eubacterial PCR is shown in [Figure 2] and that of Propionibacterium acnes PCR is shown in [Figure 3]. mPCR revealed the presence of eubacterial genome in 12 [(7 AH, 5 VF) 40%], in additional 9 specimens increasing the clinical sensitivity by 30%. The results of mPCR applied on intraocular specimens for eubacterial genome detection is shown in [Figure 4]. mPCR revealed the presence of Propionibacterium acnes genome in 4 (4 AH,13.3%).The results of mPCR applied on intraocular specimens for P. acnes genome detection is shown in [Figure 5]. mPCR revealed the presence of panfungal genome in 2 (1 AH, 1 VF 6.3% [Table 1]). The results of multiplex PCR applied on intraocular specimens for panfungal genome detection is shown in [Figure 6]. There was no striking difference in the clinical presentation of cases detected by conventional methods as against those detected only by mPCR

 :: Discussion Top

In the present study, novel mPCR was developed and applied on to intraocular specimens to detect three infectious genomes. mPCR was evaluated against individual uniplex PCR and results were on par with them. mPCR has several advantages over individual PCR: It is cost-effective as it reduces the total cost by one-third, offers considerable reduction in time required for generating reports and eliminates the need to use separate thermalcyclers for individual uPCR. The consumption of PCR reagents is minimized by carrying out the amplification in a single tube with no additional Taq polymerase required to amplify three genomes simultaneously. The annealing temperature for mPCR was determined based on the melting temperature, length (18-24 bases) and GC content of the primers. The annealing temperature of 60oC was optimal for amplifying all three infectious genomes. This novel thermal profile was designed to amplify the three infectious genomes by using 25 cycles for the first round and a reduction of five cycles for the second round without affecting the sensitivity and specificity of the procedure. Moreover, the time period needed for reporting the results was reduced by two hours compared to individual PCRs. By application of mPCR rapid diagnosis was available within five hours of specimen collection as against 8 hours required for each uPCR. Furthermore, the results of mPCR correlated well with intraocular specimens which were culture positive for bacteria. These findings are comparable to our earlier findings[2] and as well as to those published by Lohmann et al, Hykin et al and Carroll et al.[11],[12],[13],[14] This novel mPCR was extremely useful in diagnosing the infectious agent in the minimal amount of template DNA available. Moreover, this novel mPCR has several advantages over uPCR such as, detection of two or more targets in a single tube, minimizing the use of PCR reagents, reduction in time and the need for a single thermalcycler for amplification. Based on the results of mPCR appropriate therapy was initiated using antibacterial or antifungal drugs as the case may be. The newer technique of mPCR was extremely useful in management of endophthalmitis. To the best of our knowledge, this study is the first of its kind developed for etiological diagnosis of infective endophthalmitis.

 :: References Top

1.Ng JQ, Morlet N, Pearman JW, Constable IJ, McAllister IL, Kennedy CJ. et al Management and outcomes of postoperative endophthalmitis since the endophthalmitisvitrectomy study: The Endophthalmitis Population Study of Western Australia (EPSWA)'s fifth report. Ophthalmol 2005;112:1199-206.  Back to cited text no. 1    
2.Therese KL, Anand AR, Madhavan HN. Polymerase chain reaction in the diagnosis of endophthalmitis. Br J Ophthalmol 1998;82:1078-82.  Back to cited text no. 2  [PUBMED]  [FULLTEXT]
3.Okhravi N, Adamson P, Carroll N, Dunlop A, Matheson MM, Towler HM, et al . PCR based evidence of bacterial involvement in eyes with suspected intraocular infection. Invest Ophthalmol Vis Sci 2000;41:3474-9.  Back to cited text no. 3    
4.Selvapandiyan A, Stabler K, Ansari NA, Kerhy S, Riemenschneider J, Salotra P, et al . A novel semiquantitative fluorescence based multiplex polymerase chain reaction for rapid simultaneous detection of bacterial and parasitic pathogens from blood. J Mol Diagn 2005;7:268-75   Back to cited text no. 4    
5.Keya De, Ramamurthy T, Ghose AC, Islam MS, Takeda Y, Nair GB, et al . Modification of the multiplex PCR for unambiguous differentiation of the ElTor and classical biotypes of Vibrio cholerae O1.Indian J Med Res 2001;114:77-82.  Back to cited text no. 5    
6.Sugathan S, Varghese TP. Multiplex PCR on Leptospiral Isolates from Kolenchery, Kerala, India. Indian J Med Microbiol 2005;23:114-6.  Back to cited text no. 6    
7.Priya K, Madhavan HN, Malathi J. Use of uniplex polymerase chain reaction and evaluation of multiplex PCR in the rapid diagnosis of viral retinitis. Indian J Med Res 2003;117:205-10.  Back to cited text no. 7  [PUBMED]  
8.Allen SD . Anaerobic bacteria In : Lenette H, editor. Manual of Clinical Microbiology, 4th ed. American Society for Microbiology: Washington DC; 1985. p. 413-72.  Back to cited text no. 8    
9.Baron EJ, Peterson LR, Finegold SM editors. Bailey and Scott's Diagnostic Microbiology. 9th ed. Mosby Co: St. Louis; 1994. p. 79-136.  Back to cited text no. 9    
10.Collee JG, Miles RS, Watt B. Tests for identification of bacteria. In : Collee JG, Fraser AG, Marimon BP, Simmons A (editors.) Mackie and McCartney's Practical Medical Microbiology. 14th ed. Churchill Livingstone: Edinburgh; 1996. p. 131-50.  Back to cited text no. 10    
11.Anand AR, Madhavan HN, Therese KL . Use of PCR in the diagnosis of fungal endophthalmitis. Ophthalmol 2001;108:326-30.  Back to cited text no. 11    
12.Lohmann C, Linde HJ, Resischi U. Improved detection of microorganisms by PCR in delayed endophthalmitis after cataract surgery. Ophthalmol 2000;107:1047-52.   Back to cited text no. 12    
13.Hykin PG, Tobal K, McIntyre G, Matheson MM, Towler HM, Lightman SL . The diagnosis of delayed postoperative endophthalmitis by PCR of bacterial DNA in vitreous samples. J Med Microbiol 1994;40:408-15.  Back to cited text no. 13    
14.Carroll NM, Jaegger EE, Choudhury S, Dunlo AS, Matheson M, Adamson P, et al . Detection and discrimination between Gram-positive and Gram- negative bacteria in intraocular specimens by using nested PCR. J Clin Microbiol 2000;38:1753-7.  Back to cited text no. 14    

This article has been cited by
1 Diagnostic utility of polymerase chain reaction on intraocular specimens to establish the etiology of infectious endophthalmitis
Sownya, P., Madhavan, H.N.
European Journal of Ophthalmology. 2009; 19(5): 812-817
2 New insights into the management of acne: An update from the Global Alliance to Improve Outcomes in Acne Group
Thiboutot, D., Gollnick, H., Bettoli, V., Dréno, B., Kang, S., Leyden, J.J., Shalita, A.R., (...), Wolf Jr., J.
Journal of the American Academy of Dermatology. 2009; 60(5 Suppl 1): S1-S50
3 Rapid detection and quantification of Propionibacteriaceae
Goldschmidt, P., Costa Ferreira, C., Degorge, S., Benallaoua, D., Boutboul, S., Laroche, L., Batellier, L., Chaumeil, C.
British Journal of Ophthalmology. 2009; 93(2): 258-262
4 New insights into adolescent acne
Elsaie, M.L., Choudhary, S., Kammer, J.N.
Giornale Italiano di Dermatologia e Venereologia. 2009; 144(6): 645-661
5 Molecular biology applied to the laboratory diagnosis of bacterial endophthalmitis | [Biologia molecular aplicada ao diagnóstico laboratorial de endoftalmite bacteriana]
Bispo, P.J.M., Höfling-Lima, A.L., Pignatari, A.C.C.
Arquivos Brasileiros de Oftalmologia. 2009; 72(5): 734-740


Print this article  Email this article
Previous article Next article
Online since 12th February '04
© 2004 - Journal of Postgraduate Medicine
Official Publication of the Staff Society of the Seth GS Medical College and KEM Hospital, Mumbai, India
Published by Wolters Kluwer - Medknow